|
Marker Overview
Name | CGPPZ9772 |
Genbank ID | DY639772 |
Type | candidate gene marker |
Species | Prunus persica |
Primer 1 | CGPPZ9772.forward primer: GTGGTTGAATCTATAATCCG |
Primer 2 | CGPPZ9772.revers primer: CAAGTAGTCTTCAGCGTTTG |
Product Length | 750 |
Publication | [view all] |
Contact | Ignazio Verde
|
Comment | Terpene synthase/cyclase family;Ts1 |
Alignments
The following features are aligned
Publications
Year | Publication |
2017 | Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225. |
2011 | Mol Breed. 2011. 28(4):667682 |
|