MEST034, MEST034 (genetic_marker) Malus sp. | GDR

Marker Overview

Marker Overview


Name	MEST034
Genbank ID	AB627209
Type	EST-SSR
Species	Malus x domestica
Repeat Motif	(CT)19
Primer 1	MEST034.forward primer: AAATCAATGATGGAACGGGA
Primer 2	MEST034.reverse primer: CGAAGGACCAAAAATGGAGA
Publication	[view all]
Contact	Shigeki Moriya

Contact

Name

Details

Shigeki Moriya

First name:	Shigeki
Last name:	Moriya
Title:	Researcher
Institution:	Apple Research StationNARO Institute of Fruit Tree Science
Address:	Apple Research Station, NARO Institute of Fruit Tree Science, Shimokuriyagawa, Morioka, Iwate 020-0123, Japan
Country:	Japan
Email:	moriyas@affrc.go.jp

Publications


Year	Publication
2012	Moriya S, Iwanami H, Kotoda N, Haji T, Okada K, Terakami S, Mimida N, Yamamoto T, Abe K. Aligned genetic linkage maps of apple rootstock cultivar ‘JM7’ and Malus sieboldii ‘Sanashi 63’ constructed with novel EST-SSRs. Tree genetics & genomes. 2012; 8(4):709-723.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-Ba-F1-2013	Ba9	N/A	6.5	MEST034	View
2	Pear-integrated_consensus_map-IPCG-2017	LG9	N/A	29.85	MEST034	View
3	Apple-JM7xS63-F1	J9	N/A	4.9	MEST034	View
4	Apple-JM7xS63-F1	S9	N/A	10.2	MEST034	View

Alignments

Feature Name	Type	Location	Analysis
Chr09	chromosome	Chr09:1829677..1829903.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr9A	chromosome	chr9A:1725697..1725923.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation