MEST189, MEST189 (genetic_marker) Malus sp. | GDR

Marker Overview

Marker Overview


Name	MEST189
Genbank ID	AB627313
Type	EST-SSR
Species	Malus x domestica
Repeat Motif	(AGAA)4
Primer 1	MEST189.forward primer: ATAGGGCAAGAGCTCGACAA
Primer 2	MEST189.reverse primer: CCACTTGTGTTCTGGTCACG
Publication	[view all]
Contact	Shigeki Moriya

Contact

Name

Details

Shigeki Moriya

First name:	Shigeki
Last name:	Moriya
Title:	Researcher
Institution:	Apple Research StationNARO Institute of Fruit Tree Science
Address:	Apple Research Station, NARO Institute of Fruit Tree Science, Shimokuriyagawa, Morioka, Iwate 020-0123, Japan
Country:	Japan
Email:	moriyas@affrc.go.jp

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr07	chromosome	Chr07:30824370..30824575 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr7B	chromosome	chr7B:29867505..29867710 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Moriya S, Iwanami H, Kotoda N, Haji T, Okada K, Terakami S, Mimida N, Yamamoto T, Abe K. Aligned genetic linkage maps of apple rootstock cultivar ‘JM7’ and Malus sieboldii ‘Sanashi 63’ constructed with novel EST-SSRs. Tree genetics & genomes. 2012; 8(4):709-723.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-JM7xS63-F1	J7	N/A	39	MEST189	View