SAmsCN494928, SAmsCN494928 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	SAmsCN494928
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	ATC(14)
Primer 1	SAmsCN494928.forward primer: AATTATATCCGTCCGACTCCA
Primer 2	SAmsCN494928.reverse primer: TTACTGCTACCTGATGATCC
Publication	[view all]
Contact	Maria M. van Dyk

Contact

Name

Details

Maria M. van Dyk

First name:	Maria
Last name:	van Dyk
Institution:	Department of Biotechnology, University of the Western Cape, Private Bag X17
Address:	Bellville 7535, South Africa
Email:	daleen.vandyk@up.ac.za

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr14	chromosome	Chr14:32245726..32245937 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr14A	chromosome	chr14A:31442769..31443004 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2010	van Dyk MM, Soeker MK, Labuschagne IF, Rees DJG. Identification of a major QTL for time of initial vegetative budbreak in apple (Malus x domestica Borkh.). Tree Genetics and Genomes. 2010; 6(3):489-502.