LG16-1568112, LG16-1568112 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	LG16-1568112
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(AT)17
Primer 1	LG16-1568112.Forward primer: GGCATCCTAATTCCCTTGGT
Primer 2	LG16-1568112.Reverse primer: CAGGACCTGCAATTGTTACATC
Product Length	241
Publication	[view all]
Contact	Takuya Morimoto

Contact

Name

Details

Takuya Morimoto

First name:	Takuya
Last name:	Morimoto
Title:	Researcher
Institution:	Kyoto University
Address:	Graduate School of Agriculture, Kyoto University, Kyoto 606-8502, Japan
Country:	Japan
Email:	morimoto30261915@gmail.com

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr16	chromosome	Chr16:3441980..3442204 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr16A	chromosome	chr16A:2951425..2951638 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Takuya Morimoto, Koki Yonemushi, Hironori Ohnishi, Kiyoshi Banno. Genetic and Physical Mapping of QTLs for Fruit Juice Browning and Fruit Acidity on Linkage Group 16 in Apple. Tree Genetics and Molecular Breeding. 2014; 4(4):1-10.