PPO_3, PPO_3 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	PPO_3
dbSNP ID	N/A
Type	SNP
SNP Alleles	N/A
Species	Malus x domestica
Primer 1	PPO_3.forward primer: GTTCTTTGGGAACCCGTACA
Primer 2	PPO_3.reverse primer: CATCAAACTTCACAGCCACG
Publication	[view all]
Contact	Fabrizio Costa
Comment	three primer sets (PPO_1, PPO_2, PPO_3) to cover the entire gene PPO to find SNPs

Contact

Name

Details

Fabrizio Costa

First name:	Fabrizio
Last name:	Costa
Title:	Researcher
Institution:	Research and Innovation Centre, Foundation Edmund Mach
Address:	Via Mach 1, I-38010 San Michele all’Adige, Trento, Italy
Country:	Italy
Email:	fabrizio.costa@iasma.it
Phone:	390461615358
Fax:	390461650956

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr10	chromosome	Chr10:38684678..38685309 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr10A	chromosome	chr10A:39732016..39732647 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2013	Di Guardo M, Tadiello A, Farneti B, Lorenz G, Masuero D, Vrhovsek U, Costa G, Velasco R, Costa F. A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.). PloS one. 2013; 8(10):e78004.