215_106220, 215_106220 (genetic_marker) Fragaria iinumae

Marker Overview
Name215_106220
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
215_106220215_106220Fragaria iinumaemarker_locus
215_106220215_106220-44.672Fragaria iinumaemarker_locus


Sequence
>215_106220 ID=215_106220|Name=215_106220|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TCACCAATGTTGAGAAGAATAAAAGCACCAGYTCCATAAGTGCTTTTGGC
TTCACCTTTCCTGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A44.67215_106220View
2Fragaria-Fii6N/A44.67215_106220-44.672View