TP6732, TP6732 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP6732
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP6732TP6732Fragaria iinumaemarker_locus
TP6732TP6732-44.672Fragaria iinumaemarker_locus


Sequence
>TP6732 ID=TP6732|Name=TP6732|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGCTGGATTGTTGTTTTCGGGGTCTTTTATGGGAGGATATGGTCCC
AGAGAAACCTGGAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A44.67TP6732View
2Fragaria-Fii6N/A44.67TP6732-44.672View