BZIP15, BZIP15 (gene) Malus x domestica

Gene Overview
Name BZIP15
Gene Symbol BZIP15
Type gene
Organism Malus x domestica
Synonym BZIP domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIP15HM122467.1-BZIP15.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122467.1-BZIP15.m1 Chr07:4856132..4859728
chr7:4115353..4119292
chr7:4481240..4485179
HM122467.1

Sequence(s):
>HM122467.1-BZIP15.m1969
atggggatacagacaatgggatctcaaggtggggctgatggtaattgcaaacagccacagtttcagcctttgggacggca
aaactcaatgtacagtctcacattggatgaggtacagaatcagttaggtgacttggggaagccactcagcagcatgaacc
ttgatgagcttctaaaaaatgtatggagtgtggaagcaaatcagaccatgggcatagatattgaaggcacgacactggtc
aatcaagctcaactgcagcgtcaggcaagcctgtcattaactagtgcattgagcaagaagacagtcgatgaggtttggag
agatattcaacaaagcaaagatgaagaagaaaagaaatctcaagaacgacaacggactttgggagagatgactttggagg
atttcttggtcaaagccggagttgttgctgaagctgaagcatcttcggacaaacaatgtgctggtcctcttgttggggtt
gatgcgaatgtggcagcacagtttccacaaggtcagtggatgcagtactcacaaccacaatatcagcatccacaacaaag
tatgatgggggtatacatgccaagccaacctataccaccgccaatgcacgtaggggctggagctatgatggaagtcccgt
atcctgacaaccaagttccattgccttcacccttaatgggtgctctatcagatacgccgacacctgggaggaaaaggggc
aaccctgaggacattgttgagaagactgttgagcgaaggcaaaagagaatgataaagaaccgggaatctgctgcgcgttc
gcgagcaaggaagcaggcatatacaaatgaactggagaacaaagtttcacgtctggaggaggaaaatgaaaggctaagga
aacagaaggagctagagaaggtgttgcccagtgcaccgcctccggagccaaagtaccagcttcggagaacatcatcagct
ccactctga
back to top