LFY, LFY (gene) Prunus texana

Gene Overview
NameLFY
Unique NameLFY
Typegene
OrganismPrunus texana ()
Sourcetripal_genbank_parser_generic_gene
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU050741.1-LFYPrunus texanagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPrunus texanagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2021-06-03
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU050741.1-LFY N/A EU050741.1

Sequence(s):
>EU050741.1-LFY658
gtacggagtttacccaacctctcgtcttcataacctaaatgcatacgctgatttatactgtggtaaatagtaaatactaa
tagtaacttgtcgcatggactatcatacctggtcaatgtggtcccatttccgcgagtacaaacaattacaatctagtggc
tcgacaggtycaattggaaacacctgctgacaacatcaatataatgtttgagctaactctggaccgggtctgaatttttc
attgattatgtggcagagtaagttcacaagaaattttttgaaaaaaaaaagggggtttgtgaataagatcatattttaat
cctacgttggtctgaatttgatctgctttgttagaaatatatagtgattccaataatgatgttaatatgacgtagaattg
gataattggttagcttagtgattttcacactcatgttttgttcgtttgcactccgcactttgttatattttgatgatcta
tcatctgcttttatttcccaaggtagaaaaacaatagaaaagtgcaaacsgataaaatcggagtgtgaaagtcgccaccc
ttaggtatccgatatttgtaaataatgaatgatttatcttgtgaccatgacaagtgaattgttgtattttggttgtgtgg
acatgaattattgtgcag
back to top