BPPCT030, BPPCT030 (genetic_marker) Prunus persica

Marker Overview
NameBPPCT030
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmOHenry
Source TypeGenomic DNA
genomic
Repeat Motif(AG)25
PCR Condition94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1BPPCT030.F primer: AATTGTACTTGCCAATGCTATGA
Primer 2BPPCT030.Forward primer: AATTGTACTTGCCAATGCTATGA
Primer 3BPPCT030.R primer: CTGCCTTCTGCTCACACC
Primer 4BPPCT030.Reverse primer: CTGCCTTCTGCTCACACC
Product Length175
PolymorphismP_ BPPCT030
Publication[view all]
ContactE. Dirlewanger
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerBPPCT030.R primerPrunus persicaprimer
F primerBPPCT030.F primerPrunus persicaprimer
Forward primerBPPCT030.Forward primerPrunus persicaprimer
Reverse primerBPPCT030.Reverse primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BPPCT030BPPCT030Prunus persicamarker_locus
BPPCT030-1BPPCT030-1Prunus persicamarker_locus
BPPCT030BPPCT030-53.57Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Germplasm
Stock NameType
OHenrycultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-AJ-F2-2005G2N/A60.9BPPCT030View
2Prunus-TE-F2G2N/A38BPPCT030View
3Peach-DG-F1-2009G2N/A66.2BPPCT030View
4Peach-AJ-F2G2N/A60.9BPPCT030View
5Flowering Cherry-CYxE750-F1-CY2N/A65.9BPPCT030View
6Peach-LAxFG-F2LG2N/A37.6BPPCT030View
7Peach_CxEL_F1CxEL2N/A70BPPCT030View
8Prunus-TE-F2-20152N/A36.5BPPCT030View
9Peach-DvsS-BC2LG2N/A30BPPCT030View
10Apricot-BC-F1-2016B2N/A38.3BPPCT030View
11Apricot-GC-F1-2016G2N/A51.7BPPCT030View
12Prunus-TE-BC1-T1EG2_T1EN/A32.2BPPCT030View
13Prunus-TxE-peachV2.0LG2N/A38BPPCT030View
14Apricot-BC-F1-2016-PhenologyB2N/A43.7BPPCT030View
15Chokecherry-RCxSC-F1-2014RC VIIIN/A0BPPCT030-1View
16Peach_Consensus_map_20182N/A53.57BPPCT030View
Alignments
Feature NameTypeLocationAnalysis
scaffold_2 supercontig scaffold_2:22248484..22248484. Prunus persica Whole Genome v1.0 Assembly & Annotation