|
|
Marker Overview
| Name | EPDCU5060 |
|---|
| Genbank ID | BU575060 |
|---|
| Type | SSR |
|---|
| Species | Prunus dulcis |
|---|
| Germplasm | Nonpareil |
|---|
| Repeat Motif | GAT |
|---|
| PCR Condition | 94 C 2 min, 94 C 25 sec, 55 C 20 sec, 72 C 20 sec. 35 cycles, 72 C 5 min |
|---|
| Primer 1 | EPDCU5060.F primer: ACCAAATTGGACATGCAACC |
|---|
| Primer 2 | EPDCU5060.R primer: CGGTCGAGAAGACTGAGGAG |
|---|
| Product Length | 113 |
|---|
| Publication | [view all] |
|---|
| Contact | W. Howad
Amy Iezzoni
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
| 2010 | Rodríguez-Kessler M, Delgado-Sánchez P, Rodríguez-Kessler GT, Moriguchi T, Jiménez-Bremont JF. Genomic organization of plant aminopropyl transferases. Plant physiology and biochemistry : PPB / Société française de physiologie végétale. 2010 Jul; 48(7):574-90. |
|
