|
|
Marker Overview
| Name | EPPCU5990 |
|---|
| Genbank ID | BU045990 |
|---|
| Type | EST-SSR |
|---|
| Species | Prunus persica |
|---|
| Source Type | EST |
|---|
| PCR Condition | 94 C 2 min, 94 C 25 sec, 60 C 20 sec, 72 C 20 sec. 35 cycles, 72 C 5min |
|---|
| Primer 1 | EPPCU5990.F primer: AAACCAGATCAACCCTACCC |
|---|
| Primer 2 | EPPCU5990.R primer: ATGAGGAAAACCCACATCCA |
|---|
| Product Length | 188 |
|---|
| Publication | [view all] |
|---|
| Contact | P. Arus
Amy Iezzoni
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2005 | Howad W, Yamamoto T, Dirlewanger E, Testolin R, Cosson P, Cipriani G, Monforte AJ, Georgi L, Abbott AG, Arús P. Mapping with a few plants: using selective mapping for microsatellite saturation of the Prunus reference map. 2005 Nov; 171(3):1305-1309. |
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
|
