|
|
Marker Overview
| Name | pchgms5 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Prunus persica |
|---|
| Germplasm | Bicentennial |
|---|
| Source Type | Genomic DNA |
|---|
| Repeat Motif | CT and CA |
|---|
| Primer 1 | pchgms5.Forward Primer: CCAGTAGATTTCAACGTCATCTACA |
|---|
| Primer 2 | pchgms5.Reverse Primer: GGTTCACTCTCACATACACTCGGAG |
|---|
| Publication | [view all] |
|---|
| Contact | A. Abbott
Maria Badenes
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2002 | Hurtado MA, Romero C, Vilanova S, Abbott AG, Llácer G, Badenes ML. Genetic linkage maps of two apricot cultivars ( Prunus armeniaca L.), and mapping of PPV (sharka) resistance. Theoretical and Applied Genetics. 2002 Aug; 105(2-3):182-191. |
| 2007 | Dondini L, Lain O, Geuna F, Banfi R, Gaiotti F, Tartarini S, Bassi D, Testolin R. Development of a new SSR-based linkage map in apricot and analysis of synteny with existing Prunus maps. Tree Genetics and Genomes. 2007; 3(3):239–249. |
| 2000 | Theoretical and applied genetics. Theor. appl. genet. Aug 2000. v. 101 (3) p. 421-428. ISSN 0040-5752; THAGA6 |
|
