|
Marker Overview
Name | pchgms5 |
Genbank ID | N/A |
Type | SSR |
Species | Prunus persica |
Germplasm | Bicentennial |
Source Type | Genomic DNA |
Repeat Motif | CT and CA |
Primer 1 | pchgms5.Forward Primer: CCAGTAGATTTCAACGTCATCTACA |
Primer 2 | pchgms5.Reverse Primer: GGTTCACTCTCACATACACTCGGAG |
Publication | [view all] |
Contact | A. Abbott Maria Badenes
|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2002 | Hurtado MA, Romero C, Vilanova S, Abbott AG, Llácer G, Badenes ML. Genetic linkage maps of two apricot cultivars ( Prunus armeniaca L.), and mapping of PPV (sharka) resistance. Theoretical and Applied Genetics. 2002 Aug; 105(2-3):182-191. |
2007 | Dondini L, Lain O, Geuna F, Banfi R, Gaiotti F, Tartarini S, Bassi D, Testolin R. Development of a new SSR-based linkage map in apricot and analysis of synteny with existing Prunus maps. Tree Genetics and Genomes. 2007; 3(3):239–249. |
2000 | Theoretical and applied genetics. Theor. appl. genet. Aug 2000. v. 101 (3) p. 421-428. ISSN 0040-5752; THAGA6 |
|