GDsnp01598, GDsnp01598 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01598
Aliasss475882891
rs267615831
GD_SNP01598
a475882891
dbSNP IDss475882891
SNP Array ID
IRSC 9K SNP array for apple:GDsnp01598
TypeSNP
SNP AllelesG/T
SpeciesMalus x domestica
Publication[view all]
ContactCindy F. Verdu
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2013Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
Contact
NameDetails
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit textureqFT.FjxPL-ch8Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01598GDsnp01598Malus x domesticamarker_locus
GDsnp01598GDsnp01598-35.112Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp01598 ID=GDsnp01598|Name=GDsnp01598|organism=Malus x domestica|type=genetic_marker|length=201bp
CAGAGAATTGCCTGAAGTGAAACCTGGTTGGCCACTGCTTTGACGAGCCG
TACTCCCAGAGCGACAAATTCCTGAGAGGTTTATGATCCAGAAGATCTCC
KTGGTTCAGTGGGCAATGCAGTTGCCCATTAGACAGCATTCAATTGCCAG
CAATTTAGATGAAAGAAAAAATAGTTGTGATTCAGATCAACCTTCCTGTT
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map8N/A29.6GDsnp01598View
2Apple-M432-20138N/A41.4GDsnp01598View
3Apple-M432-2013-physical-Malus-domestica8N/A25196549GDsnp01598View
4Apple-FjxPL-F1-2013LG8N/A36.6GDsnp01598View
5Apple-Honeycrisp_Consensus-F18N/A35.11GDsnp01598View
Alignments
Feature NameTypeLocationAnalysis
MDC000805.390 contig MDC000805.390:21039..21039. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr08 chromosome Chr08:18462160..18462260+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr08 chromosome Chr08:18462210..18462210. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation