|
Marker Overview
Name | RosBREEDSNP_SNP_CT_7420955_Lg16_RosCOS1166_MAF50_1630221_exon7 |
dbSNP ID | ss475881814 |
SNP Array ID | 480K SNP array for apple: | AX-115182549 | IRSC 9K SNP array for apple: | RosBREEDSNP_SNP_CT_7420955_Lg16_RosCOS1166_MAF50_1630221_exon7 | 50K SNP array for apple: | AX-105186406 |
|
Type | SNP |
SNP Alleles | Y |
5' Flanking Sequence | TGTTGGAATTTCACTGGGCAGGTGGACTGGCTCAC |
3' Flanking Sequence | GAAAAGATGAGGAGTAATAACTTTACTGTCTCTG |
Species | Malus x domestica |
Publication | [view all] |
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
2012 | Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Map Positions
# | Map Name | Linkage Group | Bin | Position | Locus | MapViewer |
1 | Pear-PM-F1-Moonglow | 16 | N/A | 63.23 | RosBREED_SNP_CT_7420955_Lg16_RosCOS1166_MAF50_1630221_exon7 | View |
Sequence
>RosBREEDSNP_SNP_CT_7420955_Lg16_RosCOS1166_MAF50_1630221_exon7 ID=RosBREEDSNP_SNP_CT_7420955_Lg16_RosCOS1166_MAF50_1630221_exon7; Name=RosBREEDSNP_SNP_CT_7420955_Lg16_RosCOS1166_MAF50_1630221_exon7; organism=Malus x domestica; type=genetic_marker; length=75bp TGTTGGAATTTCACTGGGCAGGTGGACTGGCTCAC[C/T]GAAAAGATGA GGAGTAATAACTTTACTGTCTCTGC
|