fruit meltiness, qMel.XX-ch7.1-S2 (QTL) Malus x domestica

QTL Overview


QTL Label	qFRMT.XX-ch7.1-S2
Published Symbol	Melt_11_S2
Trait Name	fruit meltiness
Trait Alias	N/A
Trait Study	Apple- Fruit Texture-Ben Sadok-2015
Population	X3259_x_X3263
Female Parent	X3259
Male Parent	X3263
Colocalizing Marker	GDsnp01433
Neighboring Marker	N/A
Environment	N/A
LOD	N/A
Additivity Dominance Ratio	N/A
R2	10.4
Comments	N/A

Publications


Year	Publication
2015	Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119

Map Positions


#	Map Name	Linkage Group	Bin	Chromosome	Peak	Span Start	Span Stop	MapViewer
1	Apple-X3259X3263-F1	7	N/A	N/A	19	16	28	View

Alignments

Feature Name	Type	Location	Analysis
Chr07	chromosome	Chr07:1893634..1893733.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation

Sequences

The following sequences are available for this feature:

QTL from alignment at Chr07:1893634..1893733

QTL from alignment at Chr07:1893634..1893733

Legend: genetic_marker

Hold the cursor over a type above to highlight its positions in the sequence below.

>qFRMT.XX-ch7.1-S2 ID=qFRMT.XX-ch7.1-S2; Name=fruit meltiness; organism=Malus x domestica; type=QTL; length=100bp; location=Sequence derived from: Chr07:1893634..1893733 (Malus x domestica
CGTCTTAAAACTTGACCTTTAACATGACAAAGACCAAATAGAATACTAAA
TCAGTTCAAAGTTTCAAAACAATGATGCAGTTTATAACCTTAAACGATTT