pear psylla resistance, qPPR.PM-ch8.2 (QTL) Pyrus spp.

QTL Overview


QTL Label	qRCP.PM-ch8.2
Published Symbol	total nymphs
Trait Name	resistance to Cacopsylla pyri
Trait Alias	N/A
Trait Study	pear-Cacopsylla pyri resistance-Durel-2015
Population	PEAR3_x_Moonglow
Female Parent	PEAR3
Male Parent	Moonglow
Colocalizing Marker	CH05a02
Neighboring Marker	N/A
Environment	N/A
LOD	9.9
Additivity Dominance Ratio	N/A
R2	39.1
Comments	N/A

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr8A	chromosome	chr8A:11784847..11784953 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR QTL alignment to genome using associated markers

Publications


Year	Publication
2015	Montanari S, Guérif P, Ravon E, Denancé C, Muranty H, Velasco R, Chagné D, Bus BGM, Robert P, Perchepied L, Durel CE.. Genetic mapping of Cacopsylla pyri resistance in an interspecific pear (Pyrus spp.) population. Tree Genetics and Genomes. 2015; 11:74.

Map Positions


#	Map Name	Linkage Group	Bin	Chromosome	Peak	Span Start	Span Stop	MapViewer
1	Pear-PM-F1-PEAR3	8	N/A	N/A	16	0	30	View

Sequences

The following sequences are available for this feature:

QTL from alignment at chr8A:11784847..11784953

QTL from alignment at chr8A:11784847..11784953

Legend: genetic_marker

Hold the cursor over a type above to highlight its positions in the sequence below.

>qRCP.PM-ch8.2 ID=qRCP.PM-ch8.2; Name=resistance to Cacopsylla pyri; organism=Pyrus spp.; type=QTL; length=107bp; location=Sequence derived from: chr8A:11784847..11784953 (Malus x domestica
TTTGACCCCATAAAACCCACCCGCCGCCTCCTTCCTCCTCCGTCGTATCC
CAAACCACAGAGAGAGAGAGAGAGAGAATGTCAGGGCTAACATGCAACTC
TTGCAAC