CH05a02, CH05a02 (genetic_marker) Malus x domestica

Marker Overview
NameCH05a02
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05a02.primer 1: GTTGCAAGAGTTGCATGTTAGC
Primer 2CH05a02.primer 2: TTTTGACCCCATAAAACCCAC
Product Length111-135
111–135
Max Length130 bp
PolymorphismP_ CH05a02
Publication[view all]
ContactC. Gessler
Andreas Peil
Cindy F. Verdu
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05a02.primer 1Malus x domesticaprimer
primer 2CH05a02.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit diameterqFRDIA.JGD-G8.2008.2Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG15.J10.procyanidinC1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG15.F08.otherProcyanidinMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG15.J10.phloretinXyloglucosideMalus x domesticaQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Cacopsylla pyriqRCP.PM-ch8.1Pyrus spp.QTL
resistance to Cacopsylla pyriqRCP.PM-ch8.2Pyrus spp.QTL
resistance to Cacopsylla pyriqRCP.PM-ch8.3Pyrus spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05a02-1CH05a02-1Malus x domesticamarker_locus
CH05a02-2CH05a02-2Malus x domesticamarker_locus
CH05a02yCH05a02yMalus x domesticamarker_locus
CH05a02zCH05a02zMalus x domesticamarker_locus
CH05a02CH05a02Malus x domesticamarker_locus
CH05a02CH05a02-120.94Malus x domesticamarker_locus
CH05a02CH05a02-108.584Malus x domesticamarker_locus
CH05a02CH05a02-25.4Malus x domesticamarker_locus
CH05a02CH05a02-27.4Malus x domesticamarker_locus
CH05a02CH05a02-32.4Malus x domesticamarker_locus
Ch05a02_MCh05a02_MMalus x domesticamarker_locus
CH05a02CH05a02-78.2Malus x domesticamarker_locus
CH05a02CH05a02-78.155Malus x domesticamarker_locus
CH05a02CH05a02-78.75Malus x domesticamarker_locus
CH05a02CH05a02-90.33Malus x domesticamarker_locus
CH05a02CH05a02-34.85Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-La_France-F1-2007La8N/A28.6CH05a02-1View
2Pear-La_France-F1-2007La15N/A9.2CH05a02-2View
3Apple-FD-F1-2006F8N/A28.5CH05a02yView
4Apple-IM-F1-Mr5Mr5 LG 8N/A21.2CH05a02yView
5Apple-PF-F1-2012ch8N/A37CH05a02yView
6Apple-JGD-F1-FRRG8N/A28.7CH05a02yView
7Apple-GDxJ-F1-2012LG8N/A61CH05a02yView
8Apple-JGD-F1-2014G8N/A60.4CH05a02yView
9Apple-X5210X8402-F1-ConsensusLG15N/A4.2CH05a02yView
10Apple-X5210X8402-F1-X5210LG15N/A4.5CH05a02yView
11Apple-FD-Discovery-F1-2003D8N/A0CH05a02yView
12Apple-FD-F1-2006D15N/A8CH05a02zView
13Apple-FD-F1-2006F15N/A4.5CH05a02zView
14Apple-FD-F1-2013LG15N/A23.4CH05a02zView
15Apple-FD-Discovery-F1-2003D15N/A9.1CH05a02zView
16Apple Integrated map8N/A38CH05a02View
17Apple-IM-F1-IdaredIda LG 8N/A13.1CH05a02View
18Pear-PM-F1-PEAR38N/A15.93CH05a02View
19Pear-PM-F1-Moonglow8N/A5.08CH05a02View
20Apple-PF-F1-2012ch15N/A25CH05a02View
21Apple-X3259X3263-F18N/A43.67CH05a02View
22Apple-RGxPI6-F1LG8N/A27CH05a02View
23Apple-RGxPI6-F1LG15N/A47.6CH05a02View
24Apple-JG-F1LG8N/A84.6CH05a02View
25Apple-JGxWSH-F1LG8N/A83.1CH05a02View
26Pear-BD-F1-2014-geneticLG8N/A64.5CH05a02View
27Pear-M-F1-maleLG8N/A120.94CH05a02View
28Pear-RM-F1-IntegratedLG8N/A108.58CH05a02View
29Apple-JM7xS63-F1J8N/A25.4CH05a02View
30Apple-JM7xS63-F1S8N/A27.4CH05a02View
31Apple-JM7xS63-F1S15N/A32.4CH05a02View
32Apple-X5210X8402-F1-X8402LG8N/A35.3Ch05a02_MView
33Pear-BD-F1-2015LG8N/A78.2CH05a02View
34Pear-Bayuehong-F1-2015LG8N/A78.16CH05a02View
35Pear-Dangshansuli-F1-2015LG8N/A78.75CH05a02View
36Pear-integrated_consensus_map-IPCG-2017LG8N/A90.33CH05a02View
37Pear-integrated_consensus_map-IPCG-2017LG15N/A34.85CH05a02View
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com