MADS17, MADS17 (gene) Malus x domestica

Gene Overview
Name MADS17
Gene Symbol MADS17
Type gene
Organism Malus x domestica
Synonym MADS domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS17HM122600.1-MADS17.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122600.1-MADS17.m1 Chr04:9591049..9604843
chr10:4240499..4254328
chr10:5169988..5183817
HM122600.1

Sequence(s):
>HM122600.1-MADS17.m1660
atggtgagggggaagactcagatgaagcgcatcgaaaatgcagcgagccggcaagtgactttttccaagagaagaaatgg
gctgctgaagaaagcctttgagctttcagtcctgtgtgatgctgaagttgcacttgtgatcttctccgcaagagggaagc
tctatgagttttcgagcactagcatcagaagcacaatagaccgttaccaaatgagagtgaaggatcaaggccagctcact
actaaagcatttcaagaagatatggagcatgagacgaatgacactcaaaccttggccaaaaagatcgagtctattgaagc
ttctaaaaggaagctgttaggtaatgatttggaatcatgttccatggaggaattacatcagacagagaaccaactggagc
gaagcttaaaaaaaattagggccaaaaagcatcagttattgagggagcaaatagataagctgaaggaagaggagaaaaac
ctattggaacaaaatgcaaagctacgggaaatgtgtggcatgcaacaacttggtccttcgagaaaaagcaagcatggaga
tgatcgtgaagtattccagcctcagacaccaaatgtggacgtggagaccgatttgttcatcgggccacctaaaagacaac
aaagtggccgaaagccatag
back to top