Pchgms167 (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	Pchgms167
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Repeat Motif	(TA)21
PCR Condition	Ta 56-57C
Primer 1	pchgms167_forward: TCAATGCTTATGCTTGCTTG
Primer 2	pchgms167_reverse: AATGAATATCCACCAAATAGACTG
Product Length	230
Comment	Prunus persica v1.0 scaffold_4:12430822..12430616

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Pp04	chromosome	Pp04:12441742..12441991 .	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)	GDR marker alignment to genome using primer sequences
Pd04	chromosome	Pd04:12474679..12474904 .	Prunus dulcis Lauranne Genome v1.0	GDR marker alignment to genome using primer sequences

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-CF-F2-2014	4	N/A	55.16	pchgms167	View