EPPISF032 (genetic_marker) Prunus persica

Marker Overview
NameEPPISF032
Genbank IDDN677272
TypeSSR
SpeciesPrunus persica
Repeat Motif(ACCC)3/(TC)8
PCR Condition57
Primer 1EPPISF032.Forward: TCCCCCACAGATATTTCAGC
Primer 2EPPISF032.Reverse: GTCGAGGAGAGAGGGCTTTT
Max Length230
Publication[view all]
ContactIgnazio Verde
Contact
NameDetails
Ignazio Verde
First name:Ignazio
Last name:Verde
Title:researcher
Institution:Istituto Sperimentale per la Frutticoltura (CRA)
Address:Via di Fioranello 52, Ciampino Aeroporto, 00040 Rome, Italy
Country:Italy
Email:ignazio.verde@entecra.it
Phone:(+39) 0679348183
Fax:(+39) 0679341630
Keywords:Peach
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardEPPISF032.ForwardPrunus persicaprimer
ReverseEPPISF032.ReversePrunus persicaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
chilling requirementqCR.HU-LG4-2008.2Prunus persicaQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Monilinia fructicolaqRMF.CxEL-LG4.2010.Sk-if.2Prunus persicaQTL
resistance to Monilinia fructicolaqRMF.CxEL-LG4.2009.Sk-ifPrunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
EPPISF032EPPISF032Prunus persicamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-CF-F2-20144N/A0EPPISF032View
2Peach_CxEL_F1CxEL4N/A57.7EPPISF032View
3Peach_CxEL_F1-physical-Prunus-persicaV1.0CxEL4N/A12769735EPPISF032View
4Peach-HU-F2G4N/A64.1EPPISF032View
5Prunus-TxE-peachV2.0LG4N/A42.3EPPISF032View
6Peach-CA-BC1-2017LG4N/A41.9EPPISF032View
7Peach-CF-F2G4N/A62.7EPPISF032View