|
Marker Overview
Name | CH01c09 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GA |
PCR Condition | annealing temp 60 degree |
Primer 1 | CH01c09.primer 1: TCATCTTTCTCGCCTGCC |
Primer 2 | CH01c09.primer 2: TCCATCAAAACCAAGTTTTCG |
Product Length | 92-108 |
Polymorphism | P_ CH01c09 |
Publication | [view all] |
Contact | C. Gessler
|
Alignments
The following features are aligned
Publications
Year | Publication |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
|