Hi21e04, Hi21e04 (genetic_marker) Malus x domestica

Marker Overview
NameHi21e04
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifAAG
PCR Conditionannealing temp 60 degree
Primer 1Hi21e04.primer 1: TGGAAACCTGTTGTGGGATT
Primer 2Hi21e04.primer 2: TGCAGAGCGGATGTAAGTTG
Product Length134-161
PolymorphismP_ Hi21e04
Publication[view all]
ContactA. Patocchi
Fabrizio Costa
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Fabrizio Costa
First name:Fabrizio
Last name:Costa
Title:Researcher
Institution:Research and Innovation Centre, Foundation Edmund Mach
Address:Via Mach 1, I-38010 San Michele all’Adige, Trento, Italy
Country:Italy
Email:fabrizio.costa@iasma.it
Phone:390461615358
Fax:390461650956
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2013Di Guardo M, Tadiello A, Farneti B, Lorenz G, Masuero D, Vrhovsek U, Costa G, Velasco R, Costa F. A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.). PloS one. 2013; 8(10):e78004.
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map14N/A20.9Hi21e04View
2Apple-FD-F1-2006D14aN/A9.5Hi21e04View
3Apple-FjxPL-F1-2013LG14N/A29.44Hi21E04aView