SNP_FB_1079904, SNP_FB_1079904 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_FB_1079904
AliasF_1079904_L1_67_2
dbSNP ID.
SNP Array ID
480K SNP array for apple:SNP_FB_1079904
20K SNP array for apple:SNP_FB_1079904
TypeSNP
SNP AllelesA/C
Probe 1SNP_FB_1079904.probe: TGAGGCCTTTCTCGACCAAATTGGCCTTAGTCACATGTATAAAAGCTGTT
5' Flanking SequenceGAAAATCCAACTATTTCCAAAAATTTCCAAAATTTACCGGAATGAAGATCTCAATGAGTA
3' Flanking SequenceAACAGCTTTTATACATGTGACTAAGGCCAATTTGGTCGAGAAAGGCCTCAATTTTACCAA
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeSNP_FB_1079904.probeMalus x domesticaprobe


Sequence
>SNP_FB_1079904 ID=SNP_FB_1079904|Name=SNP_FB_1079904|organism=Malus x domestica|type=genetic_marker|length=75bp
TCCAAAATTTACCGGAATGAAGATCTCAATGAGTA[G/T]AACAGCTTTT
ATACATGTGACTAAGGCCAATTTGG
Alignments
Feature NameTypeLocationAnalysis
Chr01 chromosome Chr01:166229..166229+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation