SNP_FB_0197405, SNP_FB_0197405 (genetic_marker) Malus x domestica

Marker Overview
NameSNP_FB_0197405
AliasF_0197405_L13_PA
dbSNP ID.
SNP Array ID
480K SNP array for apple:SNP_FB_0197405
20K SNP array for apple:SNP_FB_0197405
TypeSNP
SNP AllelesA/C
Probe 1SNP_FB_0197405.probe: ATATCTCTTAATGGAGTCAAACGGCAATGCCTTGTTTATCTTGGATTGAT
5' Flanking SequenceTTAATTTCCTATATCTCTTAATGGAGTCAAACGGCAATGCCTTGTTTATCTTGGATTGAT
3' Flanking SequenceAGGTATTTTACTTTTCTTCCTTGTAGATCTGAAAGAGAGCTGATTAATGACATCGTCAAA
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeSNP_FB_0197405.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_FB_0197405SNP_FB_0197405Malus x domesticamarker_locus


Sequence
>SNP_FB_0197405 ID=SNP_FB_0197405|Name=SNP_FB_0197405|organism=Malus x domestica|type=genetic_marker|length=75bp
GTCAAACGGCAATGCCTTGTTTATCTTGGATTGAT[A/C]AGGTATTTTA
CTTTTCTTCCTTGTAGATCTGAAAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RGTxGD-F1-2015GD_1N/A2.62SNP_FB_0197405View
Alignments
Feature NameTypeLocationAnalysis
Chr01 chromosome Chr01:292000..292000- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation