WBGCAS50, WBGCAS50 (genetic_marker) Malus x domestica

Marker Overview
NameWBGCAS50
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1WBGCAS50.forward primer: GGGATCTCTAGCGTTGTGTTGC
Primer 2WBGCAS50.reverse primer: CTCCACTTTCCATCGGTGTCTG
Publication[view all]
ContactYuepeng Han
Contact
NameDetails
Yuepeng Han
First name:Yuepeng
Last name:Han
Title:Researcher
Institution:Chinese Academy of Sciences
Address:Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, the Chinese Academy of Sciences, Wuhan 430074, People’s Republic of China
Country:China
Email:yphan@wbgcas.cn
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit lengthqFRL.JGD-J15.2008Malus x domesticaQTL
fruit sizeqFRSZ.JGD-J15.2008Malus x domesticaQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerWBGCAS50.forward primerMalus x domesticaprimer
reverse primerWBGCAS50.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
WBGCAS50WBGCAS50Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-GDxJ-F1-2012LG15N/A0WBGCAS50View
2Apple-JGD-F1-2014J15N/A0WBGCAS50View