|
|
Marker Overview
| Name | H10D03 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Rosa hybrida |
|---|
| Repeat Motif | (CT)11 |
|---|
| Primer 1 | H10D03.Forward: CAATTCAAAACCACCGCTCT |
|---|
| Primer 2 | H10D03.Reverse: CGCAGAGTCAACGAACCATA |
|---|
| Publication | [view all] |
|---|
| Contact | L. Hibrand-Saint Oyant
|
|---|
Publications
| Year | Publication |
|---|
| 2008 | Hibrand-Saint Oyant L, Crespel L, Rajapakse S, Zhang L, Foucher F. Genetic linkage maps of rose constructed with new microsatellite markers and locating QTL controlling flowering traits. Tree genetics & genomes. 2008; 4(1):11-23. |
| 2010 | Debener T, Bretzke M, Dreier K, Spiller M, Linde M, Kaufmann H, Berger RG, Krings U.. Genetic and Molecular Analyses of Key Loci Involved in Self Incompatibility and Floral Scent in Roses. Acta Horticulturae. 2010; 870:183-190. |
|
