|
Marker Overview
Name | UDAp-466 |
Genbank ID | BV211265 |
Type | SSR |
Species | Prunus armeniaca |
Germplasm | Portici |
Source Type | genomic DNA |
PCR Condition | 95 C 2 min, 94 C 20 sec, 56 C 20 sec, 65 C 40 sec. 25 cycles, 65 C 7 min |
Primer 1 | UDAp-466.F primer: AATTGTGTGTGTGTGTAACTGAG |
Primer 2 | UDAp-466.R primer: TTGTTGAGAATGGGGGTACT |
Product Length | 160bp |
Publication | [view all] |
Contact | R. Testolin Maria Badenes
|
Alignments
The following features are aligned
Publications
Year | Publication |
2004 | Messina R, Lain O, Marrazzo M, Cipriani G, Testolin R. New set of microsatellite loci isolated in apricot. Molecular ecology notes. 2004; 4(3):432-434. |
2004 | Messina R, Lain O, Marrazzo MT, Huang WG, Cipriani G, Testolin R. Isolation of microsatellites from almond and apricot genomic libraries and testing for their transportability across different Prunus species. Acta Horticulturae. 2004; 663:79-82. |
2011 | Ruiz EMV, Soriano JM, Romero C, Zhebentyayeva T, Terol J, Zuriaga E, Llácer G, Abbott AG, Badenes ML. Narrowing down the apricot Plum pox virus resistance locus and comparative analysis with the peach genome syntenic region. Molecular Plant Pathology. 2011; 12(6):535–547. |
|