|
Marker Overview
Name | KNOPE6 |
Genbank ID | GU144515 |
Type | gene marker |
Species | Prunus persica |
Primer 1 | KNOPE6.forward primer: AAGTACAAGCAATACCAGTTGTG |
Primer 2 | KNOPE6.revers primer: AGTCCCAGCTGGTTTTTGGG |
Publication | [view all] |
Contact | Ignazio Verde
|
Publications
Year | Publication |
2017 | Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225. |
2012 | Testone G, Condello E, Verde I, Nicolodi C, Caboni E, Dettori MT, Vendramin E, Bruno L, Bitonti MB, Mele G, Giannino D. The peach (Prunus persica L. Batsch) genome harbours 10 KNOX genes, which are differentially expressed in stem development, and the class 1 KNOPE1 regulates elongation and lignification during primary growth. Journal of experimental botany. 2012 Sep; 63(15):5417-35. |
|