|
Marker Overview
Name | CGPAA3018 |
Genbank ID | CB823018 |
Type | candidate gene marker |
Species | Prunus persica |
Primer 1 | CGPAA3018.forward primer: TCCCCCACAACTCTAATCCA |
Primer 2 | CGPAA3018.revers primer: GGTTGTGAGGAAAGGCAAAG |
Product Length | 318 |
Publication | [view all] |
Contact | Ignazio Verde
|
Comment | UDPG-flavonoid-3-0-glucosyltransferase;3Gt3 |
Publications
Year | Publication |
2017 | Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225. |
2011 | Mol Breed. 2011. 28(4):667682 |
Alignments
Feature Name | Type | Location | Analysis |
Pp08 |
chromosome |
Pp08:15338530..15338847. |
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1) |
|