15215-12:A>T, 15215-12:A>T (genetic_marker) Fragaria x ananassa

Marker Overview
Name15215-12:A>T
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
5' Flanking SequenceTGCAGACAAAC
3' Flanking SequenceATCACACTGCTCCAAGCTTGGCTGTACTTGTAAGTTGTAACAAATCAGAGAGAGCTT
SpeciesFragaria x ananassa
Publication[view all]
ContactIraida Amaya
Contact
NameDetails
Iraida Amaya
First name:Iraida
Last name:Amaya
Title:Researcher
Institution:IFAPA-Centro de Churriana
Address:Cortijo de la Cruz S/N, Churriana, 29140 Ma´laga, Spain
Country:Florida
Email:iraida.amaya@juntadeandalucia.es
Phone:+34 951 036218
Keywords:Strawberry
Last update:2014
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
15215-12:A>T-LG315215-12:A>T-LG3-6.208Fragaria x ananassamarker_locus
15215-12:A>T15215-12:A>TFragaria x ananassamarker_locus


Sequence
>15215-12:A>T ID=15215-12:A>T|Name=15215-12:A>T|organism=Fragaria x ananassa|type=genetic_marker|length=69bp
TGCAGACAAACWATCACACTGCTCCAAGCTTGGCTGTACTTGTAAGTTGT
AACAAATCAGAGAGAGCTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Strawberry-232x1392-F1-2014LGIII-3N/A6.2115215-12:A>T-LG3View
2Strawberry-232x1392-F1-2015LGIII-3N/A5.7415215-12:A>TView