AX-89850876, AX-89850876 (genetic_marker) Fragaria x ananassa

Marker Overview
NameAX-89850876
dbSNP IDN/A
SNP Array ID
90K SNP array for cultivated strawberry:Affx-88893943
TypeSNP
SNP AllelesT/G
Probe 1AX-89850876.AX-89850876: CCACAACTCGAACTCTGGACCACCACCAGC
5' Flanking SequenceCAATCGGTGTTGAGCTTGAGACCTGGTGGTGGTCG
3' Flanking SequenceGGCGGTCCTAGACTCCTTGGTCCTCGCTTTGACTC
SpeciesFragaria x ananassa
Publication[view all]
ContactNahla Bassil
CommentSNP-SNP (haploSNP)
Contact
NameDetails
Nahla Bassil
First name:Nahla
Last name:Bassil
Title:Geneticist
Institution:USDA-ARS, NCGR, Corvallis, OR, USA
Address:USDA-ARS, NCGR, Corvallis, OR, USA
Country:USA
Email:nahla.bassil@ars.usda.gov
Phone:(541) 738-4214
Libraries
Library NameType
90K SNP array for cultivated strawberrySNP_chip
Sequence
>AX-89850876 ID=AX-89850876; Name=AX-89850876; organism=Fragaria x ananassa; type=genetic_marker; length=71bp
CAATCGGTGTTGAGCTTGAGACCTGGTGGTGGTCGKGGCGGTCCTAGACT
CCTTGGTCCTCGCTTTGACTC
Alignments
Feature NameTypeLocationAnalysis
Fvb7 chromosome Fvb7:1872605..1872675+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1 chromosome Fvb1:360427..360491+ Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb5 chromosome Fvb5:14238712..14238782- Fragaria vesca Whole Genome v2.0.a1 Assembly & Annotation
Fvb1-1 chromosome Fvb1-1:5248941..5249011+ Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb2-3 chromosome Fvb2-3:20432481..20432542- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb1-3 chromosome Fvb1-3:563099..563163- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
Fvb1-2 chromosome Fvb1-2:4950136..4950200- Fragaria x ananassa Camarosa Genome Assembly v1.0 & Annotation v1.0.a1
LG7 chromosome LG7:6301409..6301409. Fragaria vesca Whole Genome v1.1 Assembly & Annotation