MEST159, MEST159 (genetic_marker) Malus sp. | GDR

Marker Overview

Marker Overview


Name	MEST159
Genbank ID	AB627295
Type	EST-SSR
Species	Malus x domestica
Repeat Motif	(AT)9
Primer 1	MEST159.forward primer: TGCGTATAGCTCAAAACAAGC
Primer 2	MEST159.reverse primer: GGCATCGATGAAGAAGCAG
Publication	[view all]
Contact	Shigeki Moriya

Contact

Name

Details

Shigeki Moriya

First name:	Shigeki
Last name:	Moriya
Title:	Researcher
Institution:	Apple Research StationNARO Institute of Fruit Tree Science
Address:	Apple Research Station, NARO Institute of Fruit Tree Science, Shimokuriyagawa, Morioka, Iwate 020-0123, Japan
Country:	Japan
Email:	moriyas@affrc.go.jp

Publications


Year	Publication
2015	Shigeki Moriya, Hiroshi Iwanami, Takashi Haji, Kazuma Okada, Masahiko Yamada, Toshiya Yamamoto, Kazuyuki Abe. Identification and genetic characterization of a quantitative trait locus for adventitious rooting from apple hardwood cuttings. Tree Genetics & Genomes. 2015; 11:15.
2012	Moriya S, Iwanami H, Kotoda N, Haji T, Okada K, Terakami S, Mimida N, Yamamoto T, Abe K. Aligned genetic linkage maps of apple rootstock cultivar ‘JM7’ and Malus sieboldii ‘Sanashi 63’ constructed with novel EST-SSRs. Tree genetics & genomes. 2012; 8(4):709-723.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-JM7xS63-F1	J13	N/A	0	MEST159	View
2	Apple-JM7xS63-F1	S13	N/A	0	MEST159	View

Alignments

Feature Name	Type	Location	Analysis
Chr13	chromosome	Chr13:795250..795349.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr13A	chromosome	chr13A:774734..774833.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation