CBF, CBF (gene) Malus x domestica

Gene Overview
Name CBF
Gene Symbol CBF
Type gene
Organism Malus x domestica
Synonym CBF/DREB 2
CBF/DREB 3
CBF/DREB 4
DREB 2
DREB 3
DREB 4
Description NA
Comment AP2/ERF transcription factor family; low temperature response pathway
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFKC543505.1-CBF.m1Malus x domesticamRNA
CBFKC543504.1-CBF.m1Malus x domesticamRNA
CBFKC543503.1-CBF.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KC543505.1-CBF.m1 Chr06:17755035..17755746
chr6:12937652..12938363
KC543505.1
predicted genes from whole genome assembly KC543504.1-CBF.m1 Chr06:17779624..17780323
chr6:12921280..12921979
KC543504.1
predicted genes from whole genome assembly KC543503.1-CBF.m1 Chr04:9200515..9201271
chr4:4894473..4895229
chr4:5294473..5295229
KC543503.1

Sequence(s):
>KC543505.1-CBF.m1711
atgaatacgatcttcagtactcaactctccgattcctcygaaaagcccgaatcgagttccgacgacacaagcatcacggc
tcaaagccagctggcttccttctccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcggggaggagag
ttttcaaggagacgaggcacccagtttacagaggagttaggaggaggaacaacaacaagtgggtgtgcgaaatgagggaa
ccaaacaagaagaagtcgaggatatggctcggaacttatccgacggccgagatggcagctcgggcgcatgacgtggcggc
attggcctttagagggaagcttgcctgcctcaattttgcagactccgcatggcgcctgcctgttccggcatccattgatt
cagtggatatcagacgggcsgctgcggaggctgcagagacgttccggccagcggagtttggcggagtgttggaaagcggc
gatgatgagamggagagcaagaaaatggaggaggagaaggattgtggrggcgtggagggaagtggaatcttgttttactt
ggatgaggaggaaatgttcgacatgccaaggttgctggatagtatggcggaagggcttctgctctctccgcctcactctt
caggtggctacatgaactgggatgacatgggaagcaatgatgacgtcagtctgtggagcttctcaaattga
back to top
>KC543504.1-CBF.m1702
atgaatacgatcttcagtcaaatctccgattcctccgaaaagccsgaatcgagctccgacgacacaagcatcttgactcg
aagccagctggcttcgttctccgacgaggtcattttggcgtccarcaggccgaagaagcgagcrgggaggagagttttca
aggagacgaggcacccgrtttacagaggagtgaggaggaggaacaacaacaagtgggtgtgcgaaatgagagaaccaaac
aaaaagaagtcgaggatatggctcggaacttatcwgacggccgagatggcagctcgggcgcatgacgtggcggcattggc
ctttagagggaagcttgcctgcctcaattttgcagactccgtatggcgcctgcccgttccggcatccactgattcagtgg
atatcaggcgggcagcagcggaggctgcagagacsttccggccagaggagtttggcggagtgtcggaaagcggcgatgat
gagaaggagwgcaagaaaatggagggggagaaggattgtggaggcgcggaggaaagtggaatcttgttktacttggatga
ggaggaaatgttcgacatgccaaggttgctggatagtatggcggaagggcttctgctctctccacctcactcttcaggtg
gctacatgaactgggatgacatggaaagcaacgatgacgtcagtctgtggagcttctcataa
back to top
>KC543503.1-CBF.m1756
atgaacacratctccagacaactctccgattccgccgaaaggcccgaatcgagttccgaaagcgtcacgamtcgaagcca
gccgacttcgttctccgatgaggaggtcattttggcgtccagcacgccgaagaagcgagcggggaggagagttttcaacg
agacaaggcaccccgtttacagaggagtgaggaggaggaacaacgacaagtgggtgtgcgaaatgagagaaccaaacaag
aagaagtcgaggatatggctcggaacttatccaacggcagagatggcagctcgggcgcatgacgtggcggcattggcctt
tagagggaggcttgcctgcctcaattttgcagactccgcatggcgcctgcctgtcccrgcttccactgattcagtggata
tcaggcgggcggccgcggaggctgcagagacattcaggccagccgagtttggcggagtgtcggaaagtggggatgatgag
aaggagagcaagaaaatggagggggagaaggattgtggatgtgcggagcaaagcgattgtggaggtgcggagcaaagcga
ttgtggaggtgcggagcaaagtggcagctcgttttacttggatgaggaggaaatgttcgccatgccaaggttgcttgata
gtatggcggaaggscttctgctctctccacctcgccgttcagctggtagcaacatgaactgggatgatatgggaagcaat
gatgatgacgtcaatctgtggagcttctcaaagtaa
back to top