|
Marker Overview
Name | GDsnp00288 |
dbSNP ID | ss475882256 |
SNP Array ID | IRSC 9K SNP array for apple: | GDsnp00288 | 50K SNP array for apple: | AX-105217142 |
|
Type | SNP |
SNP Alleles | A/G |
5' Flanking Sequence | TTTAGTTGGAAACACAAATAAGAATTTGACCATGT |
3' Flanking Sequence | AGAGAATGTTCATTATGCTGTCAAAGAAAAG |
Species | Malus x domestica |
Publication | [view all] |
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
2013 | Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>GDsnp00288 ID=GDsnp00288; Name=GDsnp00288; organism=Malus x domestica; type=genetic_marker; length=67bp TTTAGTTGGAAACACAAATAAGAATTTGACCATGTRAGAGAATGTTCATT ATGCTGTCAAAGAAAAG
|