IAA7C, IAA7C (gene) Malus x domestica

Gene Overview
Name IAA7C
Gene Symbol IAA7C
Type gene
Organism Malus x domestica
Synonym AUX/IAA7 C
AUX/IAA7
C
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IAA7CDQ848598.1-IAA7C.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Indole acetic acid-induced proteinIAAMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ848598.1-IAA7C.m1 Chr10:28909740..28911138
chr10:19788078..19789477
chr10:22660834..22662233
DQ848598.1

Sequence(s):
>DQ848598.1-IAA7C.m1447
gggtggccaccggtgagatcttttcgaaagaacatgttcacggtggtgcaaaagagcacgaatgatggagaaagtgagca
gatgaacaagggcagcaataataatgcagttttggtgaaggttagcatggatggtgcaccataccttcgcaaggtcgact
tgaagatgtacaagagttaccctgagctctctgatgccctagccaaaatgttcagctccttcaccattggaatgaaggac
ttcatgaatgagagaaagctgatggatgttctcaacggttctgattacattccaacatacgaagacaaggatggtgattg
gatgctggttggcgatgtgccatgggagatgtttgttgaatcatgcaagagattgcgcataatgaagagcaaggaggctg
ttggactagcaccaagggccatggagaaatgcaagaacaggagctga
back to top