FRK, JX459589.1-FRK.m1 (mRNA) Malus x domestica

Unique NameJX459589.1-FRK.m1
OrganismMalus x domestica (Apple)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
FRKFRKMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JX459589.1-FRK.m1-cds1JX459589.1-FRK.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
FRKJX459589.1-FRK.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
JX459589 region JX459589:1..1161+ NCBI Rosaceae gene and mRNA sequences
Chr09 chromosome Chr09:33601785..33607464- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr9 chromosome chr9:29181644..29187456- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr9 chromosome chr9:32551701..32557513- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>JX459589.1-FRK.m1 ID=JX459589.1-FRK.m1|Name=FRK|organism=Malus x domestica|type=mRNA|length=1161bp
back to top

protein sequence of FRK

>JX459589.1-FRK.p1 ID=JX459589.1-FRK.p1|Name=FRK|organism=Malus x domestica|type=polypeptide|length=386bp
back to top

mRNA from alignment at JX459589:1..1161+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JX459589.1-FRK.m1 ID=JX459589.1-FRK.m1|Name=FRK|organism=Malus x domestica|type=mRNA|length=1161bp|location=Sequence derived from alignment at JX459589:1..1161+ (Malus x domestica)
atggctcttcattctactgctttctgcttcggcggggtggtttctttgcc tcgcaattcggtttcttttagtcagaggacagttagagcttctgcatttt cttccccaccgcctctcggttcttcctccattgctagatcgaatgtccaa ggaaaagcatttgcaggagatgcactaccggacacaaaagaatcctccct tgtggtttgttttggggaaatgctgattgattttgtcccaacgagtaatg gactttcattggctgaagcacctgcatttaaaaaagctgccggaggagcc cctgctaatgttgcagttggcatagctcgacttggtggctcatcagcttt tattggaaaggttggggaagatgaatttggatacatgcttgctgatatac taaaggagaataatgtgaacaatgaagggatgcgttttgatcccggtgca cgaactgctttagcatttgttacattgaggagtgatggggaacgtgagtt catgttttatcgtaatcctagtgctgatatgttgcttcaagaagctgaac ttgattttgatttaattaggaaggcaaaaatattacattatggttctata agtcttatcacggaaccatgcaagtcggctcatattgcagcagcaaaagc tgcaagggacgctggtgtagttctgtcctacgatcccaacctcaggcttc cactgtggccttctgcaaagagtgctagagagggaattttgagtatatgg gatactgctgatgttatcaagataagtgaagaagaggtttcttttctaac agaaggagaagatccatatgatgaaaatgttgttcgcaaattgtaccatc caaatcttaaattacttctggtcactgagggccctgatggttgcaggtac tacaccaaggagttcagtggaagagtcaagggtatgaaggtagatgcagt ggacacaactggtgctggggacgcatttgtggctggaatactatcacaac tagctgttgatctttctttgcttcaggaggaggacaaactgagagatgcg ctcgtgtttgctaacgcttgcggtgcattgactgtgacggagagaggtgc tattccggctttgccaactcgagaatctgtgttgaatgtccttctcaagt ctgtagcctag
back to top

Coding sequence (CDS) from alignment at JX459589:1..1161+

>JX459589.1-FRK.m1 ID=JX459589.1-FRK.m1|Name=FRK|organism=Malus x domestica|type=CDS|length=1161bp|location=Sequence derived from alignment at JX459589:1..1161+ (Malus x domestica)
back to top