SDH7, SDH7 (gene) Malus x domestica

Gene Overview
Name SDH7
Gene Symbol SDH7
Type gene
Organism Malus x domestica
Synonym NAD-dependent sorbitol dehydrogenase 7
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDH7AY244813.1-SDH7.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY244813.1-SDH7.m1 N/A AY244813.1

Sequence(s):
>AY244813.1-SDH7.m1966
agatcctacctttcaagctccccgctattggacccaatgatgtccggattcggattaaggcggttggtatttgtggaagc
gatgttcactacctcaggaccatgaaatgtgcggattttgaggttaaagaaccgatggtgatcggacatgagtgtgctgg
gatcgtagacaaagttgggagcgaggtgaagcatctggtgcctggtgaccgggtggcggttgagcccggtatcagttgct
cacggcgtcagcagtgcaaaggagggcagtacaatctttgccccgacatgaagtttttcgccaccccaccggttcatggt
tcattggcgaatcagattgtgcaccccgcggatctgtgctttaaattgccggaaaatgtgagcttggaagaaggggcaat
gtgtgagcccttgagtgttggggttcacgcttgtcggcgagccaatgttggtcccgaaacaactgttctgatcgtcggcg
cagggccgatcgggctggtttccgtgctggctgctcgtgctttcggagcaccaagaattgtcatcgtagatatggatgac
aggcgtttagccatggcaaagtctctcggcgccgatggcacggtcaaagtttcgataaaaatggaggatttagatgacga
agttgccaagattaaagaagctatgggatccgaagttgatgtgaccttcgactgtgttggcttcaacaaaaccatgtcta
cgggcctcaatgccactcgtcctggcggcaaagtctgccttgtcggaatgggacacggggtgatgacagtccctctcact
ccggctgctgccagggaggttgacgtggttggagtttttcgttacaagaacacatggccgctttgccttgagtttttgag
aagcgggaagatcgacgtgaagccgcttattacccaccggtttggttttaccgagaaggaggtggaagaagcaagcttgg
aattct
back to top