CNR12, KC139087.1-CNR12 (gene) Prunus avium

Unique NameKC139087.1-CNR12
OrganismPrunus avium ()

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CNR12CNR12Prunus aviumgene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
CNR12KC139087.1-CNR12.m1Prunus aviummRNA

This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
KC139087 region KC139087:1492..4258+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this gene
The following sequences are available for this feature:

gene sequence

>KC139087.1-CNR12 ID=KC139087.1-CNR12|Name=CNR12|organism=Prunus avium|type=gene|length=2767bp
back to top

gene from alignment at KC139087:1492..4258+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KC139087.1-CNR12 ID=KC139087.1-CNR12|Name=CNR12|organism=Prunus avium|type=gene|length=2767bp|location=Sequence derived from alignment at KC139087:1492..4258+ (Prunus avium)
atggctgatggaaatccccaatcgaggtacgtgaagttgacgagggaaca agaagcgccaacggaagatatcacccctggagagctcaaccaacccattc aaattcctcaggtccttctttcacttcctgggcttcgaattttttttgca gaaaatcgcaaatttgggttcatatctgagaaaaatgataatgttggatg ttggttttctgttgttttttgtgttttcttctatcttgttgcaaattagc ttctggtttgcttataattgatattcttagaaacctctcctctgttttta aattataagtgcaatgctaatgatatttctgacattgaggtgacatgttt tagtgtgcatttatctatgtgatgtacctcaatctaatgttgaaatattg tccttgttatgtttttttgttggtgttgatgattatgtttagtactggac agttaattgttgataagtgtgcggaatgtgggcaacccctgcctgaaaga taccaacccccagctgatgaagaatggacaactgggatatttggctgtgc tgaagatcctgggagttgtaagcgttcatctgctgtatcacttttcgttt tcttttttctcgggatgggaggcggtttgaaagcataattttctactttt gttgattaatcaggcgaggaaaaacagggttacatgtggcccacttatga tgattaataaggcaaagaaaaacaatgttaaaatgtgacctaatgatttg gaagttagacctttagattgtccaagttaagcaaaattgtttttttacgc aaccagttctcacctcagcaggtcagaaggctttgtgtatccaaatagga atagcattttggaaatttatgttactctcctagcttttacatattgtgtt ccttgctgagatcataatgtgcctagatttgtttggattttctgaagaaa aagagagaagatttttagattttagagtattagttgagtgagataaatta gatgtcactaccctgatggaatatattttatcacactttcctgatcattc aaaattccttgaatttattgtgtttatgttgcaggctggactggactttt ctgtccttgtgtgctgtttgggcgtaatgttgaaacaatacgagaagata ttccctggaacaatgcctgtgtttgccatgccatgtgtgttgaaggagga attgcagttgcagcagcaacaggattctttcatggtcttgatcctaagac ttcagttctcatctgtgagacattgctatttgcctggtggatgtgtgcaa tctacacaggtctgtttaggcagtcattgcaaaagaagtatcatctcaag gtgaatttcagttcctatatttcttgaaatgcaaaataaatcagatcatc tggaagaataggatgtgaataaatttctgaaatgtaaaaggcccgtgtac attcactttagataattttgtgttttctccaatttatttttgcatttttg gtaagttattttgttaaatttttttccacatgattttgctttgtacgcaa atggcttttggtgataggccctacttttaataaggtgaagtttttcttgt ctcacatataatatatagcttctgatgtgaattttatgtcatactatgaa atgttgattcatgtgtttgactttcccgttcgagtgtgatgttcttttgt tgtgtgtgtgtaaaccagatggtttgtttgctaaattgcctttgcactat cctcagctggtcagcaaatcaattatctacattgtctgctataaagagct tttagatacaagattgttttttaatcagtgtttacttcgataattttatg tgttagtagcactgatgcttcagaaagagcagacttcatttattttcatt tatatgcttgaaattttatctttcttcaatacttccttctaaacttaagt aggataaaaataaataaaaattcatttgttaatcagtttcccagatagaa tgtgaaatggatgaatttgagcctttaagtgtatttgtttacttttctgc tatcaatatctagatttaagtctctctgatgtactagcattgcatgctga aaagatgtatctaaatcaaagacctaagtggtcatagaaagaagccatca acacattagttatcaaatggtttagatactccaatttttagagctaatac ggggcccttgagacatgatatcacgggttcctgttttcaaaacctcaaga tttacagctttaaatttttggtggaaactcagaatattttgtttatgaaa gagtagcttgaggtttgtaacaattgctttcagaaaaaagtaatttagtg ttagcttttattatggaaagaaagccctgaaatctgtttcccttcctgaa aaagctaatgaactcttttaggattatttcatttgaacattaacacctat agtggtgatgggttctgacttagtgtgctacttttctgcaggattcaccc tgtgatccatgcctggtgcactgctgcatgcactggtgtgctttgtgtca agagcacagggagatgaggaaccacctatctgataatacttccaatacga tgacccttgttgcccctccaccagttcaagagatgaactctggagagaac aaggatgctgcttcgtcttcggagtcttcaggtcatgaacacaatgatgc tgcttcgtctgcagagtcttctgatcataaaaacaccaatatggagttgg ccctgcagcctgtgtag
back to top