aprigms18 (genetic_marker) Prunus armeniaca

Marker Overview
Nameaprigms18
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
GermplasmGoldrich
Source TypeBAC library
Repeat Motif(CT)25
PCR Condition94C 5 min, 94C 30 sec, 58C 30sec, 72C 45 sec, 72 sec 10 min
Primer 1aprigms18_F: TCTGAGTTCAGTGGGTAGCA
Primer 2aprigms18_R: ACAGAATGTGCGTTGCTTTA
Product Length210
PolymorphismP_ aprigms18
Publication[view all]
ContactD. Lalli
Contact
NameDetails
D. Lalli
First name:Donna
Last name:Lalli
Institution:Appalachian Fruit Research Station
Address:Appalachian Fruit Research Station, USDA-ARS, 2217 Wiltshire Road, Kearrneysville, WV 25430, USA
Country:USA
Email:Donna.Lalli@ARS.USDA.GOV
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
aprigms18_Faprigms18_FPrunus armeniacaprimer
aprigms18_Raprigms18_RPrunus armeniacaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to plum pox virusqRPPV.LV-ch1.1Prunus armeniacaQTL
resistance to plum pox virusqRPPV.HV-ch1.2Prunus armeniacaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
aprigms18aprigms18Prunus armeniacamarker_locus


Germplasm
Stock NameType
Goldrichcultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-HV-F1G1N/A16.9aprigms18View
2Apricot-LV-BC1G1N/A3.6aprigms18View
3Peach-CF-F2-20141N/A14.52aprigms18View
4Apricot-LL-F2-Lito-2011LG1N/A16.1aprigms18View
5Apricot-integrated-Goldrich-2011LG1N/A13.5aprigms18View
6Peach-HU-F2G1N/A6.9aprigms18View
7Peach-CF-F2G1N/A12.3aprigms18View