|
Marker Overview
Name | CH-Vf2 |
Genbank ID | N/A |
Type | SSR |
Species | Malus floribunda |
Repeat Motif | AT |
PCR Condition | annealing temp 60 degree |
Primer 1 | CH-Vf2.primer 1: TTTGTTTTTCGAGCAGGAGC |
Primer 2 | CH-Vf2.primer 2: TTTCACATTCGGAGCATGAG |
Product Length | 87-115 |
Publication | [view all] |
Contact | A. Patocchi T. Yamamoto
|
Publications
Year | Publication |
2004 | Plant Breeding, 123(4):321 |
2006 | Terakami S, Shoda M, Adachi Y, Gonai T, Kasumi M, Sawamura Y, Iketani H, Kotobuki K, Patocchi A, Gessler C, Hayashi T, Yamamoto T. Genetic mapping of the pear scab resistance gene Vnk of Japanese pear cultivar Kinchaku. Theoretical and Applied Genetics. 2006 Aug; 113(4):743-752. |
|