CPDCT045, CPDCT045 (genetic_marker) Prunus dulcis

Marker Overview
NameCPDCT045
Genbank IDAY862482
TypeSSR
SpeciesPrunus dulcis
GermplasmTexas
Source TypeGenomic DNA
Repeat Motif(GA)16
PCR Condition940C for 1 min, 35 cycles at 940C for 30 s, 620C for 30 s and 720C for 30 s, 720C for 5 min
Primer 1CPDCT045.F primer: TGTGGATCAAGAAAGAGAACCA
Primer 2CPDCT045.Forward Primer: TGTGGATCAAGAAAGAGAACCA
Primer 3CPDCT045.R primer: AGGTGTGCTTGCACATGTTT
Primer 4CPDCT045.Reverse Primer: AGGTGTGCTTGCACATGTTT
Product Length142 bp
Publication[view all]
ContactP. Arus
Maria Badenes
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerCPDCT045.R primerPrunus dulcisprimer
F primerCPDCT045.F primerPrunus dulcisprimer
Forward PrimerCPDCT045.Forward PrimerPrunus dulcisprimer
Reverse PrimerCPDCT045.Reverse PrimerPrunus dulcisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPDCT045CPDCT045Prunus dulcismarker_locus
CPDCT045CPDCT045-23.82Prunus dulcismarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Germplasm
Stock NameType
Texascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Almond-NL-F1-2010G4N/A31.11CPDCT045View
2Prunus-TE-F2G4N/A16.8CPDCT045View
3Prunus-TE-F2-20154N/A12.1CPDCT045View
4Peach_CxEL_F1CxEL4N/A25.6CPDCT045View
5Peach-DvsS-BC2LG4N/A23CPDCT045View
6Prunus-TE-BC1-T1EG4_T1EN/A24.7CPDCT045View
7Prunus-TxE-peachV2.0LG4N/A16.8CPDCT045View
8Peach_Consensus_map_20184N/A23.82CPDCT045View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:6205903..6206307. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:6205890..6206294+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)