GDsnp00319, GDsnp00319 (genetic_marker) Malus x domestica

Marker Overview

Name

GDsnp00319

dbSNP ID

SNP Array ID

480K SNP array for apple:	AX-105222709
IRSC 9K SNP array for apple:	GDsnp00319
20K SNP array for apple:	GDsnp00319
50K SNP array for apple:	AX-105222709

Type

SNP

SNP Alleles

A/G

Probe 1

GDsnp00319.probe: AGCAAACAACGATGGTGCAAGAACACAAACAAGTCAACCCAGACTTACCA

5' Flanking Sequence

TTTCCGAGGTTTACTAGTTTTGATTCTGAAAAATTCATATGACTCCTCCGAGCAAACAAC GATGGTGCAAGAACACAAACAAGTCAACCCAGACTTACCA
CAAACAAGTCAACCCA GACTTACCA

3' Flanking Sequence

CATAAGATGCAATTAACAAACGAATGTTGATGATTACTCTCATACGAAAAAACTGATCGA AATGCAAAACATTGNCTAATTAAGCTTAAATCAGAGNTGA
CATAAGATGCAATTAA CAAACGAAT

Species

Malus x domestica

Publication

[view all]

Contact

Michela Troggio
Cindy F. Verdu

Contact

Name

Details

Michela Troggio

First name:	Michela
Last name:	Troggio
Title:	Researcher
Institution:	Research and Innovation Centre, Fondazione Edmund Mach
Address:	Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:	Italy
Email:	ti.hcamf@oiggort.alehcim
Phone:	+39 0461 615111
Fax:	+39 0461 650218

Cindy F. Verdu

First name:	Cindy
Last name:	Verdu
Title:	Researcher
Institution:	INRA
Address:	INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:	France
Email:	cindyverdu@gmail.com

Libraries


Library Name	Type
20K SNP array for apple	SNP_chip
480K SNP array for apple	SNP_chip
IRSC 9K SNP array for apple	SNP_chip
50K SNP array for apple	SNP_chip

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
MDC022516.226	contig	MDC022516.226:3955..3955 .	Malus x domestica Whole Genome v1.0 Assembly & Annotation	n/a
Chr03	chromosome	Chr03:36699784..36699784 -	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	n/a
Chr03	chromosome	Chr03:36699734..36699834 -	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	n/a
Chr03	chromosome	Chr03:36699786..36699786 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	n/a

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
RosBREED SNP development	2011-01-01

Publications


Year	Publication
2010	Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014	Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2012	Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2014	Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
2016	Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020	Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple Integrated map	3	N/A	87.2	GDsnp00319	View
2	Apple-MM-F1	3	N/A	64	b475882726	View
3	Apple-X3259X3263-F1	3	N/A	65.27	GD_SNP00319	View
4	Apple-X5210X8402-F1-Consensus	LG3	N/A	73.8	GD_SNP00319	View
5	Apple-GDxBr-F1-2013	LG3	N/A	67.94	GD_SNP00319	View
6	Apple-Honeycrisp_Consensus-F1	3	N/A	71.04	GDsnp00319	View

Sequence

>GDsnp00319 ID=GDsnp00319; Name=GDsnp00319; organism=Malus x domestica; type=genetic_marker; length=201bp
TTTCCGAGGTTTACTAGTTTTGATTCTGAAAAATTCATATGACTCCTCCG
AGCAAACAACGATGGTGCAAGAACACAAACAAGTCAACCCAGACTTACCA
RCATAAGATGCAATTAACAAACGAATGTTGATGATTACTCTCATACGAAA
AAACTGATCGAAATGCAAAACATTGNCTAATTAAGCTTAAATCAGAGNTG
A