|
Marker Overview
Name | RosBREEDSNP_SNP_TC_18855907_Lg4_00324_MAF50_1671602_exon1 |
dbSNP ID | ss475882951 |
SNP Array ID | IRSC 9K SNP array for apple: | RosBREEDSNP_SNP_TC_18855907_Lg4_00324_MAF50_1671602_exon1 | 50K SNP array for apple: | AX-105175718 |
|
Type | SNP |
SNP Alleles | T/C |
5' Flanking Sequence | TAGCTTCTTGAGCTTCGATAACCAAATAGGTATCT |
3' Flanking Sequence | ACCGGTGATCTCACAGTAACTCATACCCAAAATT |
Species | Malus x domestica |
Publication | [view all] |
Contact | Nicola Harrison
|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2016 | Harrison N, Harrison RJ, Barber-Perez N, Cascant-Lopez E, Cobo-Medina M, Lipska M, Conde-Ruíz R, Brain P, Gregory PJ, Fernández-Fernández F. A new three-locus model for rootstock-induced dwarfing in apple revealed by genetic mapping of root bark percentage. Journal of experimental botany. 2016 Jan 29; 67(6):1871-1881. |
2012 | Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>RosBREEDSNP_SNP_TC_18855907_Lg4_00324_MAF50_1671602_exon1 ID=RosBREEDSNP_SNP_TC_18855907_Lg4_00324_MAF50_1671602_exon1; Name=RosBREEDSNP_SNP_TC_18855907_Lg4_00324_MAF50_1671602_exon1; organism=Malus x domestica; type=genetic_marker; length=70bp TAGCTTCTTGAGCTTCGATAACCAAATAGGTATCTYACCGGTGATCTCAC AGTAACTCATACCCAAAATT
|