RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1, RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1
Aliasss475876689
rs267609636
a475876689
SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1
AX-105188657
dbSNP IDss475876689
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1
50K SNP array for apple:RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCCAATCATTCATGTTATTCCAGTTGAACTTTGTCT
3' Flanking SequenceATTTGTTGAAGCTTTTATACTGGTCAGTTGTGAG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1-79.09Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1 ID=RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1|Name=RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
CCAATCATTCATGTTATTCCAGTTGAACTTTGTCTRATTTGTTGAAGCTT
TTATACTGGTCAGTTGTGAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201311N/A25.3RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1View
2Apple-M432-2013-physical-Malus-domestica1N/A10421935RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1View
3Pear-PH-CG-2017LG11N/A79.09RosBREEDSNP_SNP_AG_10421935_Lg1_RosCOS3195_MAF20_411069_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC004599.215 contig MDC004599.215:1091..1091. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:8979291..8979291. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:8979289..8979289. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation