RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10, RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10
Aliasss475879134
rs267612080
a475879134
SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10
AX-105176810
dbSNP IDss475879134
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10
50K SNP array for apple:RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTAGAAAAATCAATGAAAATTGCACTTATAAATAAT
3' Flanking SequenceGAATTAAGGGAGATGAATTAAGGAAGACTAGGTG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10 ID=RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10|Name=RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10|organism=Malus x domestica|type=genetic_marker|length=70bp
TAGAAAAATCAATGAAAATTGCACTTATAAATAATYGAATTAAGGGAGAT
GAATTAAGGAAGACTAGGTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20138N/A43.12RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10View
2Apple-M432-2013-physical-Malus-domestica8N/A22222367RosBREEDSNP_SNP_CT_22222367_Lg8_01148_MAF20_MDP0000296798_exon10View
Alignments
Feature NameTypeLocationAnalysis
MDC012482.269 contig MDC012482.269:6072..6072. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr08 chromosome Chr08:15403844..15403844. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr08 chromosome Chr08:15403843..15403843. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation