RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3, RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3
Aliasss475877023
rs267609970
b475877023
SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3
AX-105191149
dbSNP IDss475877023
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3
50K SNP array for apple:RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3
TypeSNP
SNP AllelesA/C
5' Flanking SequenceATATCGTAAAGCTCAGAAGAATGAAACGCTGACTG
3' Flanking SequenceGTCCTCTCATCTGAAGAGAAGATCACCCTACCTG
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3 ID=RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3|Name=RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3|organism=Malus x domestica|type=genetic_marker|length=70bp
ATATCGTAAAGCTCAGAAGAATGAAACGCTGACTGMGTCCTCTCATCTGA
AGAGAAGATCACCCTACCTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20132N/A8.82RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3View
2Apple-M432-2013-physical-Malus-domestica2N/A3435372RosBREEDSNP_SNP_AC_3435372_Lg2_01641_MAF30_1637004_exon3View
Alignments
Feature NameTypeLocationAnalysis
MDC018668.121 contig MDC018668.121:16617..16617. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:2812155..2812155. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr02 chromosome Chr02:2812154..2812154. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation