RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5, RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5
Aliasss475879787
rs267612733
b475879787
SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5
R_18510791_L10_40_1
dbSNP IDss475879787
SNP Array ID
480K SNP array for apple:RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5
20K SNP array for apple:RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5
50K SNP array for apple:RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5
TypeSNP
SNP AllelesA/C
Probe 1RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5.probe: GGAGAAAAGACGGTAAATCCTTAAAATTTAAATTTCAGCTGTTCCAAGCT
5' Flanking SequenceGTTAGATTTTGGGAGAAAAGACGGTAAATCCTTAAAATTTAAATTTCAGCTGTTCCAAGC T
3' Flanking SequenceACAAATTCAAAAGGTTTATATCAATAACGAGCACGTTGAAAGCCACTTACAGTTACAGCG A
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5 ID=RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5|Name=RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5|organism=Malus x domestica|type=genetic_marker|length=75bp
AATCCTTAAAATTTAAATTTCAGCTGTTCCAAGCT[A/C]ACAAATTCAA
AAGGTTTATATCAATAACGAGCACG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201310N/A51.21RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5View
2Apple-M432-2013-physical-Malus-domestica10N/A18510791RosBREEDSNP_SNP_CA_18510791_Lg10_01832_MAF30_1622972_exon5View
Alignments
Feature NameTypeLocationAnalysis
MDC017238.80 contig MDC017238.80:6158..6158. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr10 chromosome Chr10:25170067..25170067+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr10 chromosome Chr10:25170068..25170068. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation